Services on Demand
Journal
Article
Indicators
-
Cited by SciELO
Related links
-
Similars in SciELO
uBio
Share
Revista argentina de microbiología
Print version ISSN 0325-7541On-line version ISSN 1851-7617
Rev. argent. microbiol. vol.53 no.1 Ciudad Autónoma de Buenos Aires Mar. 2021
BRIEF REPORT
Cladosporium species causing ''Cladosporium rotâ on ''Boscâ pear fruit in Argentina
Especies de Cladosporium causantes de podredumbre en peras «Bosc» en Argentina
Temperini Carolina Virginia 3
Alonso Javier Néstor 1 2
Colodner Adrián Dario 2
Pose Graciela Noemi 1 2
1 Universidad Nacional de RÃo Negro, RÃo Negro, Argentina. Mitre 331, (8336) Villa Regina, Provincia de RÃo Negro, Argentina
2 Instituto Nacional de TecnologÃa Agropecuaria (INTA) - Estación Experimental Agropecuaria Alto Valle. Ruta Nacional 22, Km 1190, (8332) Allen, RÃo Negro
3 Consejo Nacional de Investigaciones CientÃficas y Tecnológicas (CONICET), Argentina
Received 26 July 2019
accepted 29 November 2019
Resumen
En los valles productivos de RÃo Negro y Neuquén, se ha reportado en los últimos años la presencia de podredumbre de peras «Bosc» causada por Cladosporium, lo que generó significativas pérdidas económicas. Las especies involucradas no fueron determinadas. Se detectó la aparición de manchas circulares negras parduzcas en peras de dicha variedad en cámaras de almacenamiento en frÃo durante 2016-2017. El objetivo del presente trabajo fue determinar las especies de Cladosporium causantes de los sÃntomas mencionados. La identificación fue llevada a cabo por caracterización morfológica y el análisis molecular de la secuencia parcial del gen de actina (ACT). Se pudo determinar que Cladosporium macrocarpum, Cladosporium subtilis-simum y Cladosporium floccosum fueron las especies implicadas. Si bien la podredumbre en peras causada por Cladosporium ha sido previamente reportada, este es el primer informe que identifica a estas especies entre los agentes causales de la enfermedad.
PALABRAS CLAVE: Pudrición por Cladosporium; Manchas por pudrición; Peras «Bosc»; Pyrus communis.
Cladosporium species can cause lesions in healthy pears according to in vitro studies5-7-14. Cladosporium herbarum was reported as a causal agent of Cladosporium rot on Bosc pear cultivars in the USA9. Moreover, the species C. herbarum and Cladosporium sp. were reported as postharvest phytopathogens of pears in the Netherlands15. Postharvest Cladosporium rots were also reported in Argentina on Beurré Bosc and Golden Russet Bosc pears in Northern Patagonia5-12. A correct and accurate identification of the species is necessary because the name of the species involves a set of characteristics such as growth features-pathogenicity or production of mycotoxins, which allow to predict their behavior1.
''Boscââ pears were affected by rot spots during cold storage (2016-2017) in the High Valley of RÃo Negro, a fruit producing region of Northern Patagonia in Argentina. The symptoms consisted of one or more brownish black circular spots that extended over the rind- light brown on the edges and dark brown to black in the center (Fig. 1). Therefore, the objective of this work was to determine the Cladosporium species that were involved in this fruit disease.
Fifteen symptomatic ''Boscââ pears, stored unprocessed during approximately 2 months in bins inside conventional cold storage chambers at -0.5 °C, were obtained from three commercial establishments (5 pieces from each). Fruits were superficially disinfected with a solution of sodium hypochlorite (1:10) for 5 minutes and rinsed by immersion twice in sterile distilled water. Infected internal tissue fragments were aseptically extracted from the spots and placed on potato dextrose agar supplemented with 0.1% chloramphenicol (PDA + C). Plates were incubated for 7 days at 25 °C.
![](/img/revistas/ram/v53n1/a04-3.jpg)
Figure 1: External symptoms of Cladosporium rot on Bosc pears.
The pathogens were identified at the genus level according to Pitt and Hocking8 as Cladosporium species. Characterization based on macroscopic features of the colonies clustered the isolates into nine different morphological groups (designated as G1 to G9). The microscopic characteristics of the isolates were determined in SNA (synthetic nutrient-poor agar) medium after 14 days of incubation at 25 °C under close UV light3. DNA extraction was performed using the DNeasy Plant Mini Kit following the manufacturerâs instructions (Qiagen, Intl) and genomic DNA was quantified with the Qubit 2.0 fluorometer (Life Technologies, Intl.). The partial sequence of the actin gene (ACT) was amplified using the primers ACT-512F: ATGTGCAAGGCCGGTTTCGC and ACT-783R: TACGAGTCCTTCTGGCCCAT to obtain resolution at the species level3,14. Sequencing of the fragments was done by Macrogen Inc. (Seoul, Korea). Pathogenicity tests were performed using the toothpick technique2 and verified according to Kochâs postulates.
After the molecular analysis, the nine different morphological groups were reduced to 3 species as causal agents of the disease. BLAST analysis of 200 bp fragments from the isolates with Cladosporium strain reference sequences obtained from the GenBank showed 100% identity to Cladosporium subtilissimum (isolate 53ACT GenBank Accession No. MG680545.1), Cladosporium macrocarpum (isolate 12ACT GenBank Accession No. MG680533.1) and Cladosporium floccosum (culture CPC 17802 GenBank Accession No. MF473823.1). As a result of the pathogenicity tests, the C. subtilissimum isolates produced a 1.5 cm lesion on the surface of the fruits with internal necrosis 1.1 cm deep (dry tissue that emerges like a plug). C. macrocarpum isolates produced an average lesion of 1.5cm on the surface of the fruit with wet internal necrosis averaging 1.7cm. C. floccosum isolates caused an external average lesion of 1 cm surrounded by a brown halo with dark brown internal necrosis extending 1.5 cm deep (dry tissue that emerges like a plug).
Cladosporium species are predominant in indoor and outdoor environments4,11,13. C. macrocarpun and C. subtilis-simum have been reported in a previous study conducted in rural environments of the High Valley of RÃo Negro productive region in Northern Patagonia in which eleven species were determined. Pathogenicity tests revealed that C. macrocarpun and C. subtilissimum, among other Cla-dosporium species, caused disease on pears14. The presence of these and other potentially phytopathogenic species in the air warns about the potential risk of infections by these
ARTICLE IN PRESS
Cladosporium species causing "Cladosporium rotââ on "Boscââ pear fruit in Argentina
causal agents during cold storage and/or growing seasons in the field. Emerging diseases can be expected in the context of climate change, such as that which has been occurring in Northern Patagonia (Argentina)6,10. These findings contribute to implementing appropriate preventive measures to reduce losses in pear production due to Cladosporium rot.
References
1. Andersen B, Kroger E, Roberts R. Chemical and morphological segregation of Alternaria alternata. A. gaisen and A. longipes. Mycological Research. 2001;105:291-9.
2. Andersen B, Kroger E, Roberts R. Chemical and morphological segregation of Alternaria arborescens A. infectoria and A. tenuissima species-groups. Mycological Research. 2002;106:170-82.
3. Bensch K, Braun U, Groenewald J, Crous P. The genus Cladosporium. Studies in Mycology. 2012;72:1-401.
4. Bensch K, Groenewald J, Meijer M, Dijksterhuis J, Jurjevi Z, Andersen B, Houbraken J, Crous P, Samson R. Cladospo-rium species in indoor environments. Studies in Mycology. 2018;89:177-301.
5. Lutz M, Sosa M, Colodner A. Effect of pre and postharvest application of fungicides on postharvest decay o Bosc pear caused by Alternaria-CÃadosporium complex in North Patagonia, Argentina. Scientia horticulturae. 2017;225:810-7.
6. Redagraria.com [Internet]. El cambio climático en el Alto Valle; 2006. [Access in: Jan. 2006]. Available from: http://www. redagraria.com/meteorologia/Alto%20Valle%20Clima.html.
7. Park Y, Kim K, Lee J, Cho S, Choi Y, Kim Y. Cladosporium sp. is the major causal agent in the microbial complex associated with the skin sooty dapple disease of the Asian pear in Korea. The Plant Pathology Journal. 2008;24:118-24.
8. Pitt J, Hocking A. Fungi and Food Spoilage. 3rd edition. New York: Springer; 2009.
9. Pscheidt J, Ocamb C, senior editors. 2019. Pacific Northwest Plant Disease Management Handbook. Corvallis, OR: Oregon State University. [On-line] http://pnwhandbooks.org/plantdisease. (Accessed 31 March 2019).
10. Inta.gob [Internet]. BoletÃn Agrometeorológico N° 24 /Mayo: Análisis agrometeorológico Temporada 2013-2014; 2014. Available from: http://inta.gob.ar/sites/default/files/script-tmp-inta-boletin_agrometeorologico-n24_2013-2014.pdf.
11. Sindt C, Besancenot J, Thibaudon M. Airborne Cladosporium fungal spores and climate change in France. Aerobiologia. 2016;32:53-68.
12. Sosa MC. Desde el campo a la conservación: Nuevos desafÃos en el manejo de enfermedades emergentes de los frutales de pepita de la Norpatagonia Argentina. XV Jornadas Fitosanitarias Argentinas. 2015. Presentación oral, Santa Fe, Argentina.
13. Temperini C, Franchi M, Benavides Rozo M, Greco M, Pardo A, Pose G. Diversity and abundance of airborne fungal spores in a rural cold dry desert environment in Argentinean Patagonia. Science of the Total Environment. 2019;665:513-20.
14. Temperini C, Pardo G, Pose G. Diversity of airborne Cla-dosporium species isolated from agricultural environments of northern Argentinean Patagonia: molecular characterization and plant pathogenicity. Aerobiologia. 2018:1-13.
15. Wenneker M, Köhl J. Postharvest decay of apples and pears in the Netherlands. In Proc.II International Symposium on Discovery and Development of Innovative Strategies for Postharvest Disease Management. 2014;1053:107-12.